Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249971

Morpholino Name: neo1 MO3
Synonyms: Xneog1b-UTR
Target mRNA: neo1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATATAGTTGTACGGGCGTCTGGGCA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:35054458..35054482 21/25 Sense off-target cox5b.2.L
Publications
First: Neogenin and RGMa control neural tube closure and neuroepithelial morphology by regulating cell polarity., J Neurosci 2008                  
Most recent:
View All Papers