Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249972

Morpholino Name: neo1 MO4
Synonyms: Neo1, XneoPan, Xneog-PAN
Target mRNA: neo1

Morpholino Type: uncategorized morpholino
Sequence: 5' CACTGCGACCCACTCTTCACCATCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 22/25
genome
MO
5' GGATGGTGAAGAGTGGCTCGCGGTG 3'
   |||||||||||||||| |||| |||
3' CCTACCACTTCTCACCCAGCGTCAC 5'
5' GGATGGTGAAGAGCGGGCCGCGGTG 3'
   ||||||||||||| ||| ||| |||
3' CCTACCACTTCTCACCCAGCGTCAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:97847555..97847579 23/25 Antisense target neo1.L
Chr3S:60819018..60819042 22/25 Antisense target neo1.S
Chr2S:160922826..160922850 22/25 Antisense off-target LOC108710030
Chr5L:1093958..1093982 22/25 unknown
tropicalis 10.0 Chr7:96460876..96460900 22/25 unknown
Publications
First: Neogenin interacts with RGMa and netrin-1 to guide axons within the embryonic vertebrate forebrain., Dev Biol 2006                        
Most recent: Netrin-1 is required for efficient neural tube closure., Dev Neurobiol 2013  
View All Papers