Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249973

Morpholino Name: neurog2 MO1
Synonyms: Ngnr1 MO
Target mRNA: neurog2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTACTCGCACTTGAGCAGCACCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genome
MO
5' GATGGTGCTGCTGAAGTGCGAGTAC 3'
   |||||||||||| ||||||||||||
3' CTACCACGACGAGTTCACGCTCATG 5'
5' GATGGTGCTGCTCAAGTGCGAGTAC 3'
   |||||||||||||||||||||||||
3' CTACCACGACGAGTTCACGCTCATG 5'
5' GATGGTGCTGCTGAAGTGCGAATAC 3'
   |||||||||||| |||||||| |||
3' CTACCACGACGAGTTCACGCTCATG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:72777407..72777431 25/25 Antisense target neurog2.L
Chr1S:57201112..57201136 23/25 Antisense target neurog2.S
Chr6L:132068119..132068143 21/25 unknown
tropicalis 10.0 Chr1:68901722..68901746 24/25 Antisense target neurog2
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent:
View All Papers