Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249975

Morpholino Name: neurog2 MO3
Synonyms: Ngnr1 MO2
Target mRNA: neurog2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTATTCGCACTTCAGCAGCACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25 25/25
genome
MO
5' ATGGTGCTGCTGAAGTGCGAGTACC 3'
   |||||||||||||||||||| ||||
3' TACCACGACGACTTCACGCTTATGG 5'
5' ATGGTGCTGCTCAAGTGCGAGTACC 3'
   ||||||||||| |||||||| ||||
3' TACCACGACGACTTCACGCTTATGG 5'
5' ATGGTGCTGCTGAAGTGCGAATACC 3'
   |||||||||||||||||||||||||
3' TACCACGACGACTTCACGCTTATGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:57201111..57201135 25/25 Antisense target neurog2.S
Chr1L:72777406..72777430 23/25 Antisense target neurog2.L
tropicalis 10.0 Chr1:68901721..68901745 24/25 Antisense target neurog2
Chr8:47956302..47956326 21/25 unknown
Publications
First: Neurogenin and NeuroD direct transcriptional targets and their regulatory enhancers., EMBO J 2007    
Most recent:
View All Papers