Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249976

Morpholino Name: nfyc MO1
Synonyms: miR-30a5p-MO
Target mRNA: nfyc

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTTCCAGTCGAGGATGTTTACAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genome
MO
5' CTGTAAACATCCTTGACTGGAAGCT 3'
   ||||||||||||| |||||||||||
3' GACATTTGTAGGAGCTGACCTTCGA 5'
5' CTGTAAACATCCTTGACTGGAAGCT 3'
   ||||||||||||| |||||||||||
3' GACATTTGTAGGAGCTGACCTTCGA 5'
5' CTGTAAACATCCTTGACTGGAAGCT 3'
   ||||||||||||| |||||||||||
3' GACATTTGTAGGAGCTGACCTTCGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:91311103..91311127 24/25 Antisense target nfyc.L
Chr2S:79405307..79405331 24/25 Antisense target nfyc.S
Chr6L:155472577..155472601 24/25 Antisense off-target LOC108719429
Chr4L:112690745..112690769 22/25 Antisense off-target foxred2.L
Chr5L:96945493..96945517 25/25 unknown
Chr5S:79074243..79074267 25/25 unknown
Chr6S:130177059..130177083 24/25 unknown
tropicalis 10.0 Chr2:87867507..87867531 24/25 Antisense target nfyc
Chr5:92563592..92563616 25/25 Antisense off-target mir30a
Chr5:92563592..92563616 25/25 Antisense off-target LOC116410933
Chr2:87867507..87867531 24/25 Antisense off-target mir30e
Chr6:144172520..144172544 24/25 Antisense off-target mir30d
Chr6:144172520..144172544 24/25 Antisense off-target LOC116411685
Publications
First: The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1., Development 2009                
Most recent:
View All Papers