Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249977

Morpholino Name: ngdn MO1
Synonyms: ngd
Target mRNA: ngdn

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATTGTACCCCACGTCTGTGTTAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GTAACACAGACGTGGGGTACAATGG 3'
   |||||||||||||||||||||||||
3' CATTGTGTCTGCACCCCATGTTACC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:151020738..151020762 25/25 Antisense target ngdn.L
Publications
First: Translational control by neuroguidin, a eukaryotic initiation factor 4E and CPEB binding protein., Mol Cell Biol 2006  
Most recent:
View All Papers