Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249987

Morpholino Name: nif MO1
Synonyms: XNIF
Target mRNA: neff1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAAGTGTAGAGCTCCCTGGAAGTCA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/26
genome
MO
5' TGACTTCCAGGGAGCTCTACACTTCA 3'
   ||||||||||||||||||||||||| 
3' ACTGAAGGTCCCTCGAGATGTGAAGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:129324479..129324504 25/26 Antisense target nif.L
Chr3S:31698481..31698506 25/26 Antisense target nif.S
Chr4L:20998905..20998930 22/26 unknown
Publications
First: hnRNP K post-transcriptionally co-regulates multiple cytoskeletal genes needed for axonogenesis., Development 2011                  
Most recent:
View All Papers