Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250168

Morpholino Name: ptf1a MO3
Synonyms: Ptf1a MO, XPtf1a/p48
Target mRNA: ptf1a

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAACTGCTCCAGGACCGTTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' ATGGAAACGGTACTGGAGCAGTTCG 3'
   ||||||||||| ||||||||||| |
3' TACCTTTGCCAGGACCTCGTCAACC 5'
5' ATGGAAACGGTCCTGGAGCAGTTGG 3'
   |||||||||||||||||||||||||
3' TACCTTTGCCAGGACCTCGTCAACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:25818664..25818688 25/25 Antisense target ptf1a.L
Chr7L:23171736..23171760 25/25 Antisense off-target sh3pxd2a.L
Chr8L:11429671..11429695 25/25 Sense off-target LOC121397116
Chr3S:126378776..126378800 24/25 Antisense off-target LOC108703407
Chr2L:81993996..81994020 22/25 Sense off-target med14.L
Chr3S:112345271..112345295 22/25 Sense off-target LOC108712409
Chr4L:50923187..50923211 21/25 Sense off-target LOC108713505
Chr3S:120957293..120957317 25/25 unknown
Chr5S:70689367..70689391 25/25 unknown
Chr6L:1813642..1813666 25/25 unknown
Chr5S:27642899..27642923 23/25 unknown
Chr1L:211825875..211825899 21/25 unknown
Chr2S:157261923..157261947 21/25 unknown
Chr5L:159829201..159829225 21/25 unknown
tropicalis 10.0 Chr6:26467870..26467894 23/25 Antisense target ptf1a
Publications
First: Combined ectopic expression of Pdx1 and Ptf1a/p48 results in the stable conversion of posterior endoderm into endocrine and exocrine pancreatic tissue., Genes Dev 2006                          
Most recent: Prdm13 forms a feedback loop with Ptf1a and is required for glycinergic amacrine cell genesis in the Xenopus Retina., Neural Dev 2017                  
View All Papers