Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250177

Morpholino Name: nectin2 MO1
Synonyms: Nec2 MO1, nec2-MO, pvrl2 MO1
Target mRNA: nectin2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CACCATTTACCCCGATCCTCTTATC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GATAAGAGGATCGGGGTAAATGGTG 3'
   |||||||||||||||||||||||||
3' CTATTCTCCTAGCCCCATTTACCAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:114827099..114827123 25/25 Antisense target nectin2.L
Chr7S:37053607..37053631 21/25 unknown
Publications
First: Nectin-2 and N-cadherin interact through extracellular domains and induce apical accumulation of F-actin in apical constriction of Xenopus neural tube morphogenesis., Development 2010                              
Most recent:
View All Papers