Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250218

Morpholino Name: rbpj MO1
Synonyms: XSu(H)1, alpha-SAUG
Target mRNA: rbpj

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGGTTGCATAGAACAATATGATG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:151789558..151789582 25/25 Sense off-target erp29.S
Chr1L:138269753..138269777 22/25 Antisense off-target rfx3.L
Chr8S:56517560..56517584 21/25 unknown
tropicalis 10.0 Chr1:163623373..163623397 24/25 Sense off-target erp29
Publications
First: EDEN-BP-dependent post-transcriptional regulation of gene expression in Xenopus somitic segmentation., Development 2004                    
Most recent: A strategy to analyze the phenotypic consequences of inhibiting the association of an RNA-binding protein with a specific RNA., RNA 2010  
View All Papers