Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250219

Morpholino Name: rbpj MO2
Synonyms: alpha-SE
Target mRNA: rbpj

Morpholino Type: uncategorized morpholino
Sequence: 5' AAACGAAACAACACAAACAAAACAA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TTGTTTTGTTTGTGTTGTTTCGTTT 3'
   |||||||||||||||||||||||||
3' AACAAAACAAACACAACAAAGCAAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:22161762..22161786 25/25 Antisense target rbpj.S
Chr2L:117147379..117147403 23/25 Antisense off-target tm2d3.L
Chr2S:80098265..80098289 23/25 Antisense off-target LOC108709590
Chr1S:162883521..162883545 22/25 Antisense off-target efna5.S
Chr5S:7352419..7352443 22/25 Antisense off-target glp1r.S
Chr4S:72565142..72565166 22/25 Sense off-target pik3r3.S
Chr1S:149842116..149842140 22/25 Antisense off-target pitpnm2.S
Chr1S:55712512..55712536 22/25 Antisense off-target LOC108706699
Chr5S:4569197..4569221 22/25 Sense off-target LOC108717374
Chr9_10S:105194728..105194752 22/25 Sense off-target LOC108703226
Chr3L:97903120..97903144 21/25 Antisense off-target neo1.L
Chr8S:30372370..30372394 21/25 Antisense off-target brd3.S
Chr9_10S:31606949..31606973 21/25 Antisense off-target cd40.S
Chr8S:37112769..37112793 21/25 Antisense off-target wnk3.S
Chr1S:142268773..142268797 21/25 Antisense off-target dgcr2.S
Chr1S:41220360..41220384 21/25 Sense off-target fstl5.S
Chr7S:95697368..95697392 21/25 Antisense off-target prss3.S
Chr9_10S:78324565..78324589 21/25 Sense off-target satb2.S
Chr2L:151485555..151485579 21/25 Sense off-target col2a1.L
Chr8L:50363385..50363409 21/25 Antisense off-target rnf128.L
Chr4S:75705242..75705266 21/25 Sense off-target LOC108715589
Chr6L:14125802..14125826 21/25 Antisense off-target LOC108718466
Chr6S:46739783..46739807 21/25 Sense off-target LOC121395042
Chr7S:95686868..95686892 21/25 Antisense off-target LOC108697257
Chr1S:60904709..60904733 23/25 unknown
Chr6S:83855241..83855265 23/25 unknown
Chr2L:44574424..44574448 22/25 unknown
Chr2S:50872838..50872862 22/25 unknown
Chr3L:75974524..75974548 22/25 unknown
Chr3S:76627435..76627459 22/25 unknown
Chr4S:132719393..132719417 22/25 unknown
Chr6S:48132908..48132932 22/25 unknown
Chr7S:103231366..103231390 22/25 unknown
Chr7S:40781267..40781291 22/25 unknown
Chr8L:51796260..51796284 22/25 unknown
Chr8L:61329362..61329386 22/25 unknown
Chr5S:28166115..28166139 22/25 unknown
Chr9_10S:13568237..13568261 22/25 unknown
Chr1L:228682979..228683003 21/25 unknown
Chr1L:97536048..97536072 21/25 unknown
Chr1L:97554237..97554261 21/25 unknown
Chr1L:97559724..97559748 21/25 unknown
Chr2L:106076645..106076669 21/25 unknown
Chr2L:37801669..37801693 21/25 unknown
Chr2L:63782632..63782656 21/25 unknown
Chr1L:147420336..147420360 21/25 unknown
Chr1L:183597327..183597351 21/25 unknown
Chr1L:216462839..216462863 21/25 unknown
Chr2S:4824949..4824973 21/25 unknown
Chr3S:114893259..114893283 21/25 unknown
Chr3S:16373870..16373894 21/25 unknown
Chr3S:63852614..63852638 21/25 unknown
Chr3S:84873151..84873175 21/25 unknown
Chr4L:114649024..114649048 21/25 unknown
Chr4L:121162728..121162752 21/25 unknown
Chr4S:104953412..104953436 21/25 unknown
Chr5L:142365546..142365570 21/25 unknown
Chr2L:84483955..84483979 21/25 unknown
Chr2S:135323637..135323661 21/25 unknown
Chr2S:159973166..159973190 21/25 unknown
Chr6L:158108603..158108627 21/25 unknown
Chr6S:14017417..14017441 21/25 unknown
Chr6S:68225422..68225446 21/25 unknown
Chr5S:131792140..131792164 21/25 unknown
Chr5S:29020302..29020326 21/25 unknown
tropicalis 10.0 Chr5:66023543..66023567 22/25 Sense off-target trdn
Chr7:57182956..57182980 22/25 Sense off-target patl1
Chr2:143762119..143762143 22/25 Sense off-target col2a1
Chr9:75388300..75388324 22/25 Sense off-target galnt13
Chr2:47857555..47857579 22/25 Antisense off-target pafah1b1
Chr1:175527977..175528001 21/25 Antisense off-target pam
Chr1:164982289..164982313 21/25 Sense off-target nos1
Chr6:109098934..109098958 21/25 Antisense off-target npc1
Chr1:44528317..44528341 21/25 Sense off-target snx25
Chr2:15134711..15134735 21/25 Antisense off-target synj1
Chr3:126619329..126619353 21/25 Antisense off-target aebp1
Chr5:33032464..33032488 21/25 Antisense off-target ehbp1
Chr5:65664344..65664368 21/25 Antisense off-target clvs2
Chr8:102103799..102103823 21/25 Antisense off-target prkch
Chr7:65613626..65613650 21/25 Antisense off-target mad2l2
Chr8:114109205..114109229 21/25 Antisense off-target sec23a
Chr7:70897857..70897881 21/25 Antisense off-target kirrel3
Chr2:157902483..157902507 21/25 Antisense off-target LOC108645819
Chr2:157902817..157902841 21/25 Antisense off-target LOC108645819
Chr2:157904679..157904703 21/25 Antisense off-target LOC108645819
Chr2:157903119..157903143 21/25 Antisense off-target LOC108645819
Chr2:157903453..157903477 21/25 Antisense off-target LOC108645819
Chr2:157904071..157904095 21/25 Antisense off-target LOC108645819
Chr1:68459984..68460008 22/25 unknown
Chr5:63817567..63817591 22/25 unknown
Chr5:91139548..91139572 22/25 unknown
Chr9:40160494..40160518 22/25 unknown
Chr9:49862233..49862257 22/25 unknown
Chr1:193207447..193207471 21/25 unknown
Chr1:217333350..217333374 21/25 unknown
Chr1:217415530..217415554 21/25 unknown
Chr1:217421111..217421135 21/25 unknown
Chr10:52387221..52387245 21/25 unknown
Chr10:52396074..52396098 21/25 unknown
Chr2:151526096..151526120 21/25 unknown
Chr2:22509..22533 21/25 unknown
Chr2:79985936..79985960 21/25 unknown
Chr3:128638628..128638652 21/25 unknown
Chr3:70758793..70758817 21/25 unknown
Chr4:11943..11967 21/25 unknown
Chr4:152999434..152999458 21/25 unknown
Chr5:118792305..118792329 21/25 unknown
Chr5:163812257..163812281 21/25 unknown
Chr5:163817927..163817951 21/25 unknown
Chr5:56343065..56343089 21/25 unknown
Chr6:140940..140964 21/25 unknown
Chr6:149394..149418 21/25 unknown
Chr6:49437143..49437167 21/25 unknown
Chr6:66752675..66752699 21/25 unknown
Chr7:133518387..133518411 21/25 unknown
Chr7:133523996..133524020 21/25 unknown
Chr7:42104578..42104602 21/25 unknown
Chr8:76746867..76746891 21/25 unknown
Chr8:91530868..91530892 21/25 unknown
Chr9:20913..20937 21/25 unknown
Chr9:26165621..26165645 21/25 unknown
Chr9:39663851..39663875 21/25 unknown
Chr6:108862..108886 21/25 unknown
Chr9:58446866..58446890 21/25 unknown
Publications
First: A strategy to analyze the phenotypic consequences of inhibiting the association of an RNA-binding protein with a specific RNA., RNA 2010  
Most recent: A gene regulation network controlled by Celf1 protein-rbpj mRNA interaction in Xenopus somite segmentation., Biol Open 2013            
View All Papers