Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250274

Morpholino Name: sall2 MO2
Synonyms: XsalF
Target mRNA: sall2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGACATCTCCACCACTCCTAATTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ACAATTAGGAGTGGTGGAGATGTCG 3'
   |||||||||||||||||||||||||
3' TGTTAATCCTCACCACCTCTACAGC 5'
5' ACAATTAGGAGTGGTGGAGATGTCG 3'
   |||||||||||||||||||||||||
3' TGTTAATCCTCACCACCTCTACAGC 5'
5' ACAATTAGGAGTGGTGGAGATGTCG 3'
   |||||||||||||||||||||||||
3' TGTTAATCCTCACCACCTCTACAGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:153900853..153900877 25/25 Antisense target sall2.L
Chr1S:131130261..131130285 25/25 Antisense target sall2.S
Chr1S:131130261..131130285 25/25 Sense off-target tox4.S
Chr3L:146873543..146873567 21/25 unknown
Chr6S:81562938..81562962 21/25 unknown
tropicalis 10.0 Chr1:141941903..141941927 25/25 Antisense target sall2
Chr5:43115048..43115072 21/25 unknown
Publications
First: Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling., Dev Cell 2004              
Most recent:
View All Papers