Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250277

Morpholino Name: sdc1 MO2
Synonyms: xSyn1.2 MO
Target mRNA: sdc1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGGGCAACCAATAACTTGTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 23/25
genome
MO
5' ATGGACAAGTTATTGGTTGCCCTGT 3'
   |||||||||||||||||||||||||
3' TACCTGTTCAATAACCAACGGGACA 5'
5' ATGGACAAGTTACTGGCTGCCCTGT 3'
   |||||||||||| ||| ||||||||
3' TACCTGTTCAATAACCAACGGGACA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:154597153..154597177 23/25 Antisense target sdc1.L
Chr5S:130701914..130701938 22/25 Antisense off-target LOC108718258
Chr8S:79841903..79841927 21/25 Sense off-target degs3.S
tropicalis 10.0 Chr5:143228342..143228366 25/25 Antisense target sdc1
Chr7:95634748..95634772 21/25 Sense off-target lrrc38
Chr2:71208875..71208899 21/25 unknown
Publications
First: Syndecan-1 regulates BMP signaling and dorso-ventral patterning of the ectoderm during early Xenopus development., Dev Biol 2009      
Most recent:
View All Papers