Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250279

Morpholino Name: sdc4 MO2
Synonyms: Sdc4, syn4 MO2, xSyn4.2 MO
Target mRNA: sdc4

Morpholino Type: translation blocking morpholino
Sequence: 5' CTAAAAGCAGCAGGAGGCGATTCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ATGAATCGCCTCCTGCTGCTTTTAG 3'
   |||||||||||||||||||||||||
3' TACTTAGCGGAGGACGACGAAAATC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:3909384..3909408 25/25 Antisense target sdc4.L
Chr9_10L:49646894..49646918 21/25 Sense off-target LOC121398206
Chr9_10L:49658307..49658331 21/25 Sense off-target LOC121398206
Chr9_10L:49669715..49669739 21/25 Sense off-target LOC121398206
Chr9_10L:49687495..49687519 21/25 Sense off-target LOC121398206
tropicalis 10.0 Chr1:130331395..130331419 21/25 Sense off-target cemip2
Publications
First: Syndecan-4 regulates non-canonical Wnt signalling and is essential for convergent and extension movements in Xenopus embryos., Nat Cell Biol 2006  
Most recent: Cell contacts and pericellular matrix in the Xenopus gastrula chordamesoderm., PLoS One 2024                    
View All Papers