Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250280

Morpholino Name: sdcbp MO1
Synonyms: Xsyntenin-a
Target mRNA: sdcbp

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGACCTGCCGACAGTCGAATAAG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 22/25
genome
MO
5' CTTATTCGACTGTCGGCAGGTAAGC 3'
   |||||||||||||||||||||  | 
3' GAATAAGCTGACAGCCGTCCAGACA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:101946334..101946358 22/25 Antisense target sdcbp.S
Chr6L:125033353..125033377 21/25 unknown
Publications
First: The postsynaptic density 95/disc-large/zona occludens protein syntenin directly interacts with frizzled 7 and supports noncanonical Wnt signaling., Mol Biol Cell 2008                    
Most recent:
View All Papers