Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250281

Morpholino Name: sdcbp MO2
Synonyms: Xsyntenin-a
Target mRNA: sdcbp

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGGGATATAGAGACATTTTCACAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 23/25
genome
MO
5' CTGTAAAAATGTCTCTGTATCCCTC 3'
   |||| ||||||||||| ||||||||
3' GACACTTTTACAGAGATATAGGGAG 5'
5' CTGTGAAAATGTCTCTATATCCCTC 3'
   |||||||||||||||||||||||||
3' GACACTTTTACAGAGATATAGGGAG 5'
5' CTGTAAAAATGTCTCTGTATCCCTC 3'
   |||| ||||||||||| ||||||||
3' GACACTTTTACAGAGATATAGGGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:124315340..124315364 25/25 Antisense target sdcbp.L
Chr6S:101957647..101957671 23/25 Antisense target sdcbp.S
Chr9_10L:58545145..58545169 21/25 Sense off-target cntnap5.L
Chr1S:134739018..134739042 21/25 unknown
Chr6L:109028233..109028257 21/25 unknown
Chr9_10S:25777448..25777472 21/25 unknown
tropicalis 10.0 Chr6:116379390..116379414 23/25 Antisense target sdcbp
Chr5:81627520..81627544 21/25 Antisense off-target sim1
Chr2:149219016..149219040 21/25 unknown
Publications
First: The postsynaptic density 95/disc-large/zona occludens protein syntenin directly interacts with frizzled 7 and supports noncanonical Wnt signaling., Mol Biol Cell 2008                    
Most recent:
View All Papers