Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250282

Morpholino Name: sdr16c5 MO1
Synonyms: Rdhe2
Target mRNA: sdr16c5

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGCGTCTCTAAGAAAATGTTCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' GATGAATATTTTCTTAGAGACACTC 3'
   |||||| |||||||||||||| |||
3' CTACTTGTAAAAGAATCTCTGCGAG 5'
5' GATGAACATTTTCTTAGAGACGCTC 3'
   |||||||||||||||||||||||||
3' CTACTTGTAAAAGAATCTCTGCGAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:123713698..123713722 25/25 Antisense target sdr16c5.L
Chr6L:96441455..96441479 21/25 Sense off-target hivep1.L
Chr7S:14020605..14020629 21/25 unknown
Chr7L:108456286..108456310 21/25 unknown
tropicalis 10.0 Chr6:115831187..115831211 23/25 Antisense target sdr16c5
Publications
First: Short chain dehydrogenase/reductase rdhe2 is a novel retinol dehydrogenase essential for frog embryonic development., J Biol Chem 2012                
Most recent:
View All Papers