Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250283

Morpholino Name: sema3a MO1
Synonyms:
Target mRNA: sema3a

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCAATCCAGGTCAGAGAGCCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' CATGGGCTCTCCGACCTGGATTGCA 3'
   ||||||||||| |||||||||||||
3' GTACCCGAGAGACTGGACCTAACGT 5'
5' CATGGGCTCTCTGACCTGGATTGCA 3'
   |||||||||||||||||||||||||
3' GTACCCGAGAGACTGGACCTAACGT 5'
5' CATGGGCTCTCTGACCTGGATTGCA 3'
   |||||||||||||||||||||||||
3' GTACCCGAGAGACTGGACCTAACGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:86246008..86246032 25/25 Antisense target sema3a.L
Chr3S:70695473..70695497 25/25 Antisense target sema3a.S
Chr8S:43662409..43662433 21/25 unknown
tropicalis 10.0 Chr3:80346483..80346507 24/25 Antisense target sema3a
Publications
First: Neogenin interacts with RGMa and netrin-1 to guide axons within the embryonic vertebrate forebrain., Dev Biol 2006                        
Most recent:
View All Papers