Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250284

Morpholino Name: sema3a MO2
Synonyms: xSema3A
Target mRNA: sema3a

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGCAATCCAGGTCAGAGAGCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' ATGGGCTCTCCGACCTGGATTGCAT 3'
   |||||||||| ||||||||||||||
3' TACCCGAGAGACTGGACCTAACGTA 5'
5' ATGGGCTCTCTGACCTGGATTGCAT 3'
   |||||||||||||||||||||||||
3' TACCCGAGAGACTGGACCTAACGTA 5'
5' ATGGGCTCTCTGACCTGGATTGCAT 3'
   |||||||||||||||||||||||||
3' TACCCGAGAGACTGGACCTAACGTA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:86246007..86246031 25/25 Antisense target sema3a.L
Chr3S:70695474..70695498 25/25 Antisense target sema3a.S
tropicalis 10.0 Chr3:80346482..80346506 24/25 Antisense target sema3a
Chr7:127508364..127508388 21/25 unknown
Publications
First: Semaphorin 3A induces CaV2.3 channel-dependent conversion of axons to dendrites., Nat Cell Biol 2011  
Most recent:
View All Papers