Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250285

Morpholino Name: senp3 MO1
Synonyms: SENP3
Target mRNA: senp3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGGATAACAGCCGTAGTGTCTCCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GGGAGACACTACGGCTGTTATCCGG 3'
   |||||||||||||||||||||||||
3' CCCTCTGTGATGCCGACAATAGGCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:159912544..159912568 25/25 Antisense target senp3.L
Publications
First: Identification and developmental expression of Xenopus laevis SUMO proteases., PLoS One 2009            
Most recent:
View All Papers