Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250286

Morpholino Name: set MO1
Synonyms: TAF1 MO, TAF1BMO
Target mRNA: set

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTTGTGTGTGAGGAGAGGTGGT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' ACCACCTCTCCTCACACACAACATG 3'
   |||||||||||||||||||||||||
3' TGGTGGAGAGGAGTGTGTGTTGTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:32859739..32859763 25/25 Antisense target set.S
Chr7L:98741039..98741063 22/25 Sense off-target foxj3.L
Chr6S:126063402..126063426 21/25 Sense off-target fer1l6.S
Chr2L:187241219..187241243 21/25 Sense off-target LOC108707614
tropicalis 10.0 Chr6:62066917..62066941 22/25 Sense off-target nt5c3a
Publications
First: The cytoplasmic domain of Xenopus NF-protocadherin interacts with TAF1/set., Dev Cell 2003    
Most recent: A requirement for NF-protocadherin and TAF1/Set in cell adhesion and neural tube formation., Dev Biol 2006                      
View All Papers