Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250288

Morpholino Name: sfrp1 MO2
Synonyms:
Target mRNA: sfrp1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCTTAATCCGGAAGAACAAGGTTC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GAACCTTGTTCTTCCGGATTAAGGT 3'
   |||||||||||||||||||||||||
3' CTTGGAACAAGAAGGCCTAATTCCA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:135024382..135024406 25/25 Antisense target sfrp1.L
Publications
First: sfrp1 promotes cardiomyocyte differentiation in Xenopus via negative-feedback regulation of Wnt signalling., Development 2013                                      
Most recent: Secreted Frizzled-related Protein 2 (sFRP2) Redirects Non-canonical Wnt Signaling from Fz7 to Ror2 during Vertebrate Gastrulation., J Biol Chem 2016                
View All Papers