Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250289

Morpholino Name: sfrp1 MO3
Synonyms: Sfrp-1 MO
Target mRNA: sfrp1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCAAATTCCACCTTCGGAATTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 24/25
genome
MO
5' ATGAATTCCGAAGGTGGAATTTGGC 3'
   |||||||||||||||||||||||||
3' TACTTAAGGCTTCCACCTTAAACCG 5'
5' ATGAATTCTGAAGGTGGAATTTGGC 3'
   |||||||| ||||||||||||||||
3' TACTTAAGGCTTCCACCTTAAACCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:26100469..26100493 24/25 Antisense target sfrp1.S
tropicalis 10.0 Chr3:127008111..127008135 25/25 Antisense target sfrp1
Chr2:131988163..131988187 21/25 unknown
Publications
First: Antagonistic cross-regulation between Wnt and Hedgehog signalling pathways controls post-embryonic retinal proliferation., Development 2012                      
Most recent:
View All Papers