Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250290

Morpholino Name: sfrp5 MO1
Synonyms: sfrp5 MO, sfrp5-MO
Target mRNA: sfrp5

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCCCAAATGTGGAAAAAGCCAATG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CATTGGCTTTTTCCACATTTGGGAG 3'
   |||||||||||||||||||||||||
3' GTAACCGAAAAAGGTGTAAACCCTC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:29870236..29870260 25/25 Antisense target sfrp5.L
Chr8L:42105096..42105120 21/25 Antisense off-target col4a6.L
Chr3L:109936714..109936738 21/25 Antisense off-target fam227b.L
Chr1L:48942251..48942275 21/25 unknown
Chr1L:52534607..52534631 21/25 unknown
Chr3S:10367555..10367579 21/25 unknown
Publications
First: Sfrp5 coordinates foregut specification and morphogenesis by antagonizing both canonical and noncanonical Wnt11 signaling., Genes Dev 2008                          
Most recent:
View All Papers