Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250291

Morpholino Name: sfrp5 MO2
Synonyms: Translation-inhibiting sfrp5-MO2
Target mRNA: sfrp5

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAAATATTCCACTGAAATCGCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CATGCGATTTCAGTGGAATATTTTG 3'
   |||||||||||||||||||||||||
3' GTACGCTAAAGTCACCTTATAAAAC 5'
5' CATGCGATTTCAGTGGAATATTTTG 3'
   |||||||||||||||||||||||||
3' GTACGCTAAAGTCACCTTATAAAAC 5'
5' CATGCGATTTCAGTGGAATATTTTG 3'
   |||||||||||||||||||||||||
3' GTACGCTAAAGTCACCTTATAAAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:29870207..29870231 25/25 Antisense target sfrp5.L
Chr7S:27310773..27310797 25/25 Antisense target sfrp5.S
Chr2S:34466396..34466420 22/25 Antisense off-target map7d2.S
Chr2S:99771193..99771217 21/25 Antisense off-target dmd.1.S
Chr4L:137966471..137966495 21/25 Antisense off-target slc6a8l.L
Chr5L:58904209..58904233 21/25 Antisense off-target LOC101027285
Chr2S:79642389..79642413 21/25 Antisense off-target LOC108709590
Chr4S:119752131..119752155 21/25 unknown
Chr5S:104773274..104773298 21/25 unknown
Chr2L:177392796..177392820 21/25 unknown
Chr6S:89572146..89572170 21/25 unknown
Chr8S:97297701..97297725 21/25 unknown
tropicalis 10.0 Chr7:33950781..33950805 25/25 Antisense target sfrp5
Chr5:56181998..56182022 21/25 Antisense off-target lyst
Chr3:44541132..44541156 21/25 Antisense off-target fbxo38
Chr9:53791530..53791554 21/25 Sense off-target tmem237
Publications
First: Sfrp5 coordinates foregut specification and morphogenesis by antagonizing both canonical and noncanonical Wnt11 signaling., Genes Dev 2008                          
Most recent:
View All Papers