Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250292

Morpholino Name: sfrp5 MO3
Synonyms: XsFRP5-MO1
Target mRNA: sfrp5

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCGCATGATTTCTCCAAAAAGTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25 25/25
genome
MO
5' CCACCTTTGGGGGAAATCATGCGAT 3'
   |||| ||| || |||||||||||||
3' GGTGAAAAACCTCTTTAGTACGCTA 5'
5' CCACATTTGGGAGAAATCATGCGAT 3'
   |||| ||| ||||||||||||||||
3' GGTGAAAAACCTCTTTAGTACGCTA 5'
5' CCACTTTTTGGAGAAATCATGCGAT 3'
   |||||||||||||||||||||||||
3' GGTGAAAAACCTCTTTAGTACGCTA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:27310756..27310780 25/25 Antisense target sfrp5.S
Chr7L:29870224..29870248 23/25 Antisense target sfrp5.L
Chr6L:24722909..24722933 21/25 unknown
tropicalis 10.0 Chr7:33950798..33950822 22/25 Antisense target sfrp5
Chr2:78026814..78026838 21/25 unknown
Publications
First: XsFRP5 modulates endodermal organogenesis in Xenopus laevis., Dev Biol 2009        
Most recent:
View All Papers