Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250293

Morpholino Name: sfrp5 MO4
Synonyms: XsFRP5-MO2
Target mRNA: sfrp5

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTAACCCAAAGGCTTATCCTCCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' CAGGAGGATAAGCCTTTGGGTTAAA 3'
   |||||||||||||||||||||||||
3' GTCCTCCTATTCGGAAACCCAATTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:27310700..27310724 25/25 Antisense target sfrp5.S
Chr9_10L:82771523..82771547 21/25 Antisense off-target LOC398368
Chr3S:76145656..76145680 21/25 unknown
Chr9_10L:78594646..78594670 21/25 unknown
tropicalis 10.0 Chr1:149793933..149793957 21/25 unknown
Chr6:31837479..31837503 21/25 unknown
Publications
First: XsFRP5 modulates endodermal organogenesis in Xenopus laevis., Dev Biol 2009        
Most recent:
View All Papers