Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250294

Morpholino Name: sfrp5 MO5
Synonyms: X.tropicalis sfrp5 splice-inhibiting MO, sfrp5 splice-inhibiting MO
Target mRNA: sfrp5

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGGAAGGAAGTATTTTACCCTGGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 22/26
genome
MO
5' CCACCAGGTAAAATACTTCCTTCCTT 3'
   |  |  ||||||||||||||||||||
3' GTGGTCCCATTTTATGAAGGAAGGAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:10516245..10516270 22/26 Sense off-target robo2.S
Chr6S:118527262..118527287 22/26 Antisense off-target LOC108719750
tropicalis 10.0 Chr7:33950269..33950294 22/26 Antisense target sfrp5
Publications
First: Sfrp5 coordinates foregut specification and morphogenesis by antagonizing both canonical and noncanonical Wnt11 signaling., Genes Dev 2008                          
Most recent:
View All Papers