Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250313

Morpholino Name: six1 MO1
Synonyms: Six1MO1, six1
Target mRNA: six1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAAGGCAGCATAGACATGGCTCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CTGAGCCATGTCTATGCTGCCTTCC 3'
   |||||||||||||||||||||||||
3' GACTCGGTACAGATACGACGGAAGG 5'
5' CTGAGCCATGTCTATGCTGCCTTCC 3'
   |||||||||||||||||||||||||
3' GACTCGGTACAGATACGACGGAAGG 5'
5' CTGAGCCATGTCTATGCTGCCTTCC 3'
   |||||||||||||||||||||||||
3' GACTCGGTACAGATACGACGGAAGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:93775026..93775050 25/25 Antisense target six1.L
Chr8S:7856150..7856174 25/25 Antisense target six1.S
Chr1L:62955907..62955931 22/25 Antisense off-target LOC121400575
Chr1L:62687954..62687978 22/25 Antisense off-target LOC108710142
Chr1L:63038048..63038072 22/25 Antisense off-target LOC121402894
Chr1L:62641578..62641602 22/25 unknown
Chr1L:62969260..62969284 22/25 unknown
tropicalis 10.0 Chr8:102415763..102415787 25/25 Antisense target six1
Publications
First: Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor., Development 2004                      
Most recent: Mcrs1 interacts with Six1 to influence early craniofacial and otic development., Dev Biol 2020                    
View All Papers