Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250506

Morpholino Name: nemp1 MO1
Synonyms: nemp1a, tmem194a MO1
Target mRNA: nemp1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTAAATTACCTGAGGCCAATGTAC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GTACATTGGCCTCAGGTAATTTAAA 3'
   |||||||||||||||||||||||||
3' CATGTAACCGGAGTCCATTAAATTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:130765582..130765606 25/25 Antisense target nemp1.S
tropicalis 10.0 Chr4:76298370..76298394 21/25 Antisense off-target coq9
Publications
First: Involvement of an inner nuclear membrane protein, Nemp1, in Xenopus neural development through an interaction with the chromatin protein BAF., Dev Biol 2009              
Most recent: The Inner Nuclear Membrane Protein Nemp1 Is a New Type of RanGTP-Binding Protein in Eukaryotes., PLoS One 2015                                  
View All Papers