Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250563

Morpholino Name: ubp1 MO1
Synonyms: ubp1
Target mRNA: ubp1

Morpholino Type: uncategorized morpholino
Sequence: 5' AAAGTAGGGAATGCACCTTAAAAAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' GTTTTTAAGGTGCGTTTCCTACTTT 3'
   ||||||||||||| || ||||||||
3' CAAAAATTCCACGTAAGGGATGAAA 5'
5' GTTTTTAAGGTGCATTCCCTACTTT 3'
   |||||||||||||||||||||||||
3' CAAAAATTCCACGTAAGGGATGAAA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:2188406..2188430 25/25 Antisense target ubp1.S
Chr9_10L:2443483..2443507 23/25 Antisense target ubp1.L
Chr3L:147925577..147925601 21/25 unknown
tropicalis 10.0 Chr1:181090566..181090590 23/25 unknown
Chr2:59338826..59338850 21/25 unknown
Publications
First: Specification of ion transport cells in the Xenopus larval skin., Development 2011                                            
Most recent:
View All Papers