Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250568

Morpholino Name: unc5b MO1
Synonyms: Unc5B-ATG MO
Target mRNA: unc5b

Morpholino Type: uncategorized morpholino
Sequence: 5' GGATAAATGCATCGCTTAGCGTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genome
MO
5' GAGACGCTAAGCGATGCATTTATCC 3'
   |||||||||||||||||||||||||
3' CTCTGCGATTCGCTACGTAAATAGG 5'
5' GAGCCGCTAAGCGATGTATTTATCC 3'
   ||| |||||||||||| ||||||||
3' CTCTGCGATTCGCTACGTAAATAGG 5'
5' GAGTCGCTAAGCGATGTATTTATCC 3'
   ||| |||||||||||| ||||||||
3' CTCTGCGATTCGCTACGTAAATAGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:45050040..45050064 23/25 Antisense target unc5b.L
Chr7S:35899943..35899967 23/25 Antisense target unc5b.S
tropicalis 10.0 Chr7:46910665..46910689 25/25 Antisense target unc5b
Publications
First: Unc5B interacts with FLRT3 and Rnd1 to modulate cell adhesion in Xenopus embryos., PLoS One 2009                
Most recent:
View All Papers