Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250570

Morpholino Name: ngfr MO1
Synonyms: morpholino against p75NTR, p75ntr MO
Target mRNA: ngfr

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGGTTTCCATGCTGATCCTAGAAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' CTTTATAGGATCAGCATGGAAACCC 3'
   |||| ||||||||||||||||||||
3' GAAAGATCCTAGTCGTACCTTTGGG 5'
5' CTTTCTAGGATCAGCATGGAAACCC 3'
   |||||||||||||||||||||||||
3' GAAAGATCCTAGTCGTACCTTTGGG 5'
5' CTTTATAGGATCAGCATGGAAACCC 3'
   |||| ||||||||||||||||||||
3' GAAAGATCCTAGTCGTACCTTTGGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:4481386..4481410 25/25 Antisense target ngfr.L
Chr9_10S:4239767..4239791 24/25 Antisense target ngfr.S
tropicalis 10.0 Chr10:14207191..14207215 24/25 Antisense target ngfr
Publications
First: Postsynaptic TRPC1 function contributes to BDNF-induced synaptic potentiation at the developing neuromuscular junction., J Neurosci 2011                  
Most recent:
View All Papers