Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250571

Morpholino Name: ngfr MO2
Synonyms: p75NTR morpholino, p75ntr
Target mRNA: ngfr

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCATGCTGATCCTAGAAAGCTGATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' CATCAGCTTTATAGGATCAGCATGG 3'
   |||||||||| ||||||||||||||
3' GTAGTCGAAAGATCCTAGTCGTACC 5'
5' CATCAGCTTTCTAGGATCAGCATGG 3'
   |||||||||||||||||||||||||
3' GTAGTCGAAAGATCCTAGTCGTACC 5'
5' CATCAGCTTTATAGGATCAGCATGG 3'
   |||||||||| ||||||||||||||
3' GTAGTCGAAAGATCCTAGTCGTACC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:4481380..4481404 25/25 Antisense target ngfr.L
Chr9_10S:4239761..4239785 24/25 Antisense target ngfr.S
tropicalis 10.0 Chr10:14207185..14207209 24/25 Antisense target ngfr
Publications
First: Pro-BDNF-induced synaptic depression and retraction at developing neuromuscular synapses., J Cell Biol 2009                
Most recent:
View All Papers