Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250572

Morpholino Name: usp15 MO1
Synonyms: USP15
Target mRNA: usp15

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCCCTCCGCCATCTTACTCACTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 20/24 21/24
genome
MO
5' AGTGGAGTAAGATGGCGGAGGGCG 3'
   |   ||||||||||||||||||||
3' TTCACTCATTCTACCGCCTCCCGC 5'
5' AGTGGAGGAAGATGGCGGAGGGCG 3'
   |   ||| ||||||||||||||||
3' TTCACTCATTCTACCGCCTCCCGC 5'
5' AGTGGAGTAAGATGGCGGAGGGCG 3'
   |   ||||||||||||||||||||
3' TTCACTCATTCTACCGCCTCCCGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:85303075..85303098 21/24 Antisense target usp15.S
Chr3L:69543123..69543146 20/24 Antisense target usp15.L
Chr2L:168058783..168058806 20/24 Antisense off-target pspc1.L
Chr6S:56739466..56739489 20/24 unknown
tropicalis 10.0 Chr3:62761993..62762016 21/24 Antisense target usp15
Publications
First: USP15 is a deubiquitylating enzyme for receptor-activated SMADs., Nat Cell Biol 2011  
Most recent: USP15 targets ALK3/BMPR1A for deubiquitylation to enhance bone morphogenetic protein signalling., Open Biol 2014                
View All Papers