Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250574

Morpholino Name: usp9x MO1
Synonyms: FAM-MO
Target mRNA: usp9x

Morpholino Type: uncategorized morpholino
Sequence: 5' TCGTGGCTGTCATACTCGACACAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CCTGTGTCGAGTATGACAGCCACGA 3'
   |||||||||||||||||||||||||
3' GGACACAGCTCATACTGTCGGTGCT 5'
5' CCTGTGTCGAGTATGACAGCCACGA 3'
   |||||||||||||||||||||||||
3' GGACACAGCTCATACTGTCGGTGCT 5'
5' CCTGTGTCGAGTATGACAGCCACGA 3'
   |||||||||||||||||||||||||
3' GGACACAGCTCATACTGTCGGTGCT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:82064404..82064428 25/25 Antisense target usp9x.L
Chr2S:49105684..49105708 25/25 Antisense target usp9x.S
Chr6S:108765366..108765390 21/25 unknown
tropicalis 10.0 Chr2:56837476..56837500 25/25 Antisense target usp9x
Publications
First: FAM/USP9x, a deubiquitinating enzyme essential for TGFbeta signaling, controls Smad4 monoubiquitination., Cell 2009    
Most recent:
View All Papers