Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250575

Morpholino Name: vamp3 MO1
Synonyms: V3 MO, VAMP3 MO
Target mRNA: vamp3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACACCGGTCCGACTTTACTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 22/22
genome
MO
5' GAGTAAAGTCGGACCGGTGTCC 3'
   ||||||||||||||||||||||
3' CTCATTTCAGCCTGGCCACAGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:105821974..105821995 22/22 Antisense off-target vamp1.L
tropicalis 10.0 Chr7:101174903..101174924 22/22 Antisense target vamp3
Publications
First: Identification of a novel Bves function: regulation of vesicular transport., EMBO J 2010  
Most recent:
View All Papers