Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250577

Morpholino Name: vangl2 MO2
Synonyms: Xstbm
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTTGGCGGATTTGGGTCCCCCCGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genome
MO
5' TCGGGGGGACCCAAACCCGCCAACG 3'
   ||||||||||||||| |||||||||
3' AGCCCCCCTGGGTTTAGGCGGTTGC 5'
5' TCGGGGGGACCCAAATCCGCCAACG 3'
   |||||||||||||||||||||||||
3' AGCCCCCCTGGGTTTAGGCGGTTGC 5'
5' TCGGGGGGACCCAAACCCGCCAACT 3'
   ||||||||||||||| |||||||| 
3' AGCCCCCCTGGGTTTAGGCGGTTGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:127346554..127346578 25/25 Antisense target vangl2.L
Chr8S:99085647..99085671 23/25 Antisense target vangl2.S
Chr1L:92062920..92062944 21/25 unknown
tropicalis 10.0 Chr8:137136617..137136641 24/25 Antisense target vangl2
Publications
First: The planar polarity gene strabismus regulates convergent extension movements in Xenopus., EMBO J 2002  
Most recent: PCP and Septins govern the polarized organization of the actin cytoskeleton during convergent extension., Curr Biol 2024                  
View All Papers