Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250578

Morpholino Name: vangl2 MO3
Synonyms: Vangl2
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTACCGGCTTTTGTGGCGATCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 24/24 24/24
genome
MO
5' TGGAACGGCACAAAAGCCGCTACT 3'
   |||| || ||||||||||| ||||
3' ACCTAGCGGTGTTTTCGGCCATGA 5'
5' TGGATCGCCACAAAAGCCGGTACT 3'
   ||||||||||||||||||||||||
3' ACCTAGCGGTGTTTTCGGCCATGA 5'
5' TGGATCGCCACAAAAGCCGGTACT 3'
   ||||||||||||||||||||||||
3' ACCTAGCGGTGTTTTCGGCCATGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:112211847..112211870 24/24 Antisense target vangl2.L
chr8S:94049619..94049642 24/24 Antisense target vangl2.S
tropicalis 10.0 Chr8:137136593..137136616 21/24 Antisense target vangl2
Publications
First: Syndecan 4 interacts genetically with Vangl2 to regulate neural tube closure and planar cell polarity., Development 2013              
Most recent:
View All Papers