Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250579

Morpholino Name: vav2 MO1
Synonyms: xVav2 MO
Target mRNA: vav2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGCCGCCAGCCCTCAGTCATGTTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' CAACATGACTGAGGGCTGGAGACAG 3'
   ||||||||||||||||||| | |||
3' GTTGTACTGACTCCCGACCGCCGTC 5'
5' CAACATGACTGAGGGCTGGCGGCAG 3'
   |||||||||||||||||||||||||
3' GTTGTACTGACTCCCGACCGCCGTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:30407641..30407665 25/25 Antisense target vav2.S
Chr8L:5645966..5645990 23/25 Antisense target vav2.L
Publications
First: Balanced Vav2 GEF activity regulates neurite outgrowth and branching in vitro and in vivo., Mol Cell Neurosci 2010  
Most recent:
View All Papers