Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250580

Morpholino Name: vcl MO1
Synonyms: Vinculin-MO
Target mRNA: vcl

Morpholino Type: uncategorized morpholino
Sequence: 5' TATGGAAGACCGGCATCTTGGCAAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 23/25 25/25
genome
MO
5' ACTGCCAAGATGCCGGTCTTCCACA 3'
   | ||||||||||||||||||||| |
3' TAACGGTTCTACGGCCAGAAGGTAT 5'
5' ATTGCCAAGATGCCGGTCTTCCATA 3'
   |||||||||||||||||||||||||
3' TAACGGTTCTACGGCCAGAAGGTAT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:44215163..44215187 25/25 Antisense target vcl.S
tropicalis 10.0 Chr7:55385460..55385484 23/25 Antisense target vcl
Publications
First: A dominant-negative provides new insights into FAK regulation and function in early embryonic morphogenesis., Development 2013  
Most recent: Decoupling the Roles of Cell Shape and Mechanical Stress in Orienting and Cueing Epithelial Mitosis., Cell Rep 2019                
View All Papers