Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250581

Morpholino Name: vegfa MO1
Synonyms: X.tropicalis VEGFA, gi:77626411
Target mRNA: vegfa

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGTGAGGCTACAGTGTAACAGTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' ACACTGTTACACTGTAGCCTCACCG 3'
   |||||||||||||||||||||||||
3' TGTGACAATGTGACATCGGAGTGGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:154653835..154653859 21/25 unknown
tropicalis 10.0 Chr5:1641549..1641573 25/25 Antisense target vegfa
Chr9:83265617..83265641 22/25 Antisense off-target asic4
Chr10:14417027..14417051 21/25 unknown
Chr4:121230625..121230649 21/25 unknown
Publications
First: The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development., Development 2008                  
Most recent:
View All Papers