Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250582

Morpholino Name: vegfa MO2
Synonyms: VEGF-MO, VEGFA-MO
Target mRNA: vegfa

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCCAGCTCGGCAGAAAGTTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CATGAACTTTCTGCCGAGCTGGATC 3'
   |||||||||||||||||||||||||
3' GTACTTGAAAGACGGCTCGACCTAG 5'
5' CATGAACTTTCTGCCGAGCTGGATC 3'
   |||||||||||||||||||||||||
3' GTACTTGAAAGACGGCTCGACCTAG 5'
5' CATGAACTTTCTGCCGAGCTGGATC 3'
   |||||||||||||||||||||||||
3' GTACTTGAAAGACGGCTCGACCTAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:24447050..24447074 25/25 Antisense target vegfa.L
Chr5S:6516437..6516461 25/25 Antisense target vegfa.S
Chr5L:101150583..101150607 21/25 Sense off-target LOC108716910
tropicalis 10.0 Chr5:1641716..1641740 25/25 Antisense target vegfa
Publications
First: Paracrine and autocrine mechanisms of apelin signaling govern embryonic and tumor angiogenesis., Dev Biol 2007                            
Most recent: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus., Development 2013                                                                                                                              
View All Papers