Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250583

Morpholino Name: vegfc MO1
Synonyms: xVEGF-C
Target mRNA: vegfc

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCCCTCCAGCAAGTACATTTTCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' GGAAAATGCACTTGCTGGAGGGAGC 3'
   |||||||| ||||||||||||||||
3' CCTTTTACATGAACGACCTCCCTCG 5'
5' GGAAAATGTACTTGCTGGAGGGAGC 3'
   |||||||||||||||||||||||||
3' CCTTTTACATGAACGACCTCCCTCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:36553414..36553438 25/25 Antisense target vegfc.S
Chr1L:50168896..50168920 24/25 Antisense target vegfc.L
Chr5L:94324501..94324525 21/25 Sense off-target lca5.L
Chr9_10L:108502314..108502338 21/25 unknown
Publications
First: A genetic Xenopus laevis tadpole model to study lymphangiogenesis., Nat Med 2005  
Most recent: A transgenic Xenopus laevis reporter model to study lymphangiogenesis., Biol Open 2013              
View All Papers