Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250584

Morpholino Name: vegfc MO2
Synonyms: VEGFC morpholino
Target mRNA: vegfc

Morpholino Type: uncategorized morpholino
Sequence: 5' GTAACGCTCCCTCCAGCAAGTACAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 22/25 25/25
genome
MO
5' ATGCACTTGCTGGAGGGAGCGCTGC 3'
   ||| ||||||||||||||||| | |
3' TACATGAACGACCTCCCTCGCAATG 5'
5' ATGTACTTGCTGGAGGGAGCGTTAC 3'
   |||||||||||||||||||||||||
3' TACATGAACGACCTCCCTCGCAATG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:36553419..36553443 25/25 Antisense target vegfc.S
Chr1L:50168901..50168925 22/25 Antisense target vegfc.L
Chr6S:102815183..102815207 22/25 unknown
Publications
First: miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo., Mol Cell Biol 2010  
Most recent:
View All Papers