Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250585

Morpholino Name: vegt MO1
Synonyms: anit MO, antipodean/vegT
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTTTACATCCGGCAGAGAATGCAT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:86091567..86091591 21/25 unknown
Publications
First: Snail2 controls mesodermal BMP/Wnt induction of neural crest., Development 2011                    
Most recent:
View All Papers