Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250590

Morpholino Name: vegt MO6
Synonyms: VegTMO
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCCGACAGCAGTTTCTCATTCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' TGCAATGAGAAACTGCTGTCAGGAA 3'
   || ||||||||||||||||| ||||
3' ACCTTACTCTTTGACGACAGCCCTT 5'
5' TGGAATGAGAAACTGCTGTCGGGAA 3'
   |||||||||||||||||||||||||
3' ACCTTACTCTTTGACGACAGCCCTT 5'
5' TGGAATGAGAAACTGCTGTCGGGAA 3'
   |||||||||||||||||||||||||
3' ACCTTACTCTTTGACGACAGCCCTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:165681272..165681296 25/25 Antisense target vegt.L
Chr1S:142004128..142004152 25/25 Antisense target vegt.S
Chr9_10L:51799154..51799178 21/25 Sense off-target cox10.L
Chr3L:38524861..38524885 21/25 Antisense off-target LOC108710910
Chr5L:117745660..117745684 21/25 Sense off-target LOC108716206
Chr5L:29604098..29604122 22/25 unknown
Chr5S:2835042..2835066 21/25 unknown
tropicalis 10.0 Chr1:152863074..152863098 23/25 Antisense target vegt
Chr10:4383089..4383113 21/25 Antisense off-target taf4
Chr5:30906644..30906668 22/25 unknown
Publications
First: Reversal of Xenopus Oct25 function by disruption of the POU domain structure., J Biol Chem 2010  
Most recent:
View All Papers