Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250591

Morpholino Name: vegt MO7
Synonyms: vegt MO
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGACAGCAGTTTCTCATTCCACG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 23/25 23/25
genome
MO
5' GCTGCAATGAGAAACTGCTGTCAGG 3'
     || ||||||||||||||||| ||
3' GCACCTTACTCTTTGACGACAGCCC 5'
5' GCTGGAATGAGAAACTGCTGTCGGG 3'
     |||||||||||||||||||||||
3' GCACCTTACTCTTTGACGACAGCCC 5'
5' GCTGGAATGAGAAACTGCTGTCGGG 3'
     |||||||||||||||||||||||
3' GCACCTTACTCTTTGACGACAGCCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:165681274..165681298 23/25 Antisense target vegt.L
Chr1S:142004130..142004154 23/25 Antisense target vegt.S
Chr7L:4017983..4018007 21/25 Antisense off-target eno4.L
tropicalis 10.0 Chr1:152863076..152863100 21/25 Antisense target vegt
Publications
First: Long- and short-range signals control the dynamic expression of an animal hemisphere-specific gene in Xenopus., Dev Biol 2008              
Most recent:
View All Papers