Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250592

Morpholino Name: vegt MO8
Synonyms: apod MO
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTTGTACGTAAGAGACGGCCTAC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: The RNA-binding protein XSeb4R: a positive regulator of VegT mRNA stability and translation that is required for germ layer formation in Xenopus., Genes Dev 2008            
Most recent:
View All Papers