Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250593

Morpholino Name: ventx2.1 MO1
Synonyms: Xvent2
Target mRNA: ventx2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGTCTGTATTAGTCCTTGTGTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' GAACACAAGGACTACTACAGGAAAG 3'
   |||||||||||||| |||||  |||
3' CTTGTGTTCCTGATTATGTCTGTTC 5'
5' GAACACAAGGACTAATACAGACAAG 3'
   |||||||||||||||||||||||||
3' CTTGTGTTCCTGATTATGTCTGTTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:21807371..21807395 25/25 Antisense target ventx2.1.L
Chr7S:16928497..16928521 25/25 Antisense target ventx2.1.S
Chr7L:21777299..21777323 25/25 Antisense off-target ventx2.2.L
Chr7S:16903332..16903356 25/25 Antisense off-target ventx2.2.S
Chr8L:18302459..18302483 22/25 Antisense off-target rabepk.L
Chr4L:59623492..59623516 22/25 unknown
Chr2L:162563507..162563531 21/25 unknown
tropicalis 10.0 Chr7:26905802..26905826 22/25 Antisense target ventx2.1
Chr7:26877266..26877290 22/25 Antisense off-target ventx2.2
Chr8:28205962..28205986 21/25 Antisense off-target rabepk
Chr4:22086902..22086926 21/25 unknown
Publications
First: Patterning the forebrain: FoxA4a/Pintallavis and Xvent2 determine the posterior limit of Xanf1 expression in the neural plate., Development 2004    
Most recent:
View All Papers